Top » Catalog » SNPs » FGC3213

$18.00

FGC3213
[FGC3213]

FGC3213
hg38 Position: ChrY:24575993..24575993
Ancestral: A
Derived: C
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1
Comments: Found in a R-DF21 person
Forward Primer: FGC3213_F TTATGGCTATCAGACAACCACTTT
Reverse Primer: FGC3213_R CTCTGGTCTCTAGGGGAAAACAT
Reviews

Customers who bought this product also purchased
FGC14589
FGC14589
Z245
Z245
BY12129
BY12129
CTS9219
CTS9219
DF19
DF19
Y113338
Y113338
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies