Top » Catalog » SNPs » S190

$18.00

S190
[S190]

S190
hg38 Position: ChrY:12090435..12090435
Ancestral: T
Derived: C
Reference: Jim Wilson
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b1a
Comments: Aka. CTS2187
Forward Primer: S190_F TTTCTGGGTCTGGCTTTGTC
Reverse Primer: S190_R ATGGGTATCCTTTGCTGGTG
Reviews

Customers who bought this product also purchased
Z36747
Z36747
Z39298
Z39298
Z29546
Z29546
FGC3216
FGC3216
Z17994
Z17994
Z29552
Z29552
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies