Top » Catalog » SNPs » S424

$18.00

S424
[S424]

S424
hg38 Position: ChrY:15249500..15249500
Ancestral: A
Derived: C
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b1
Comments: .
Forward Primer: S424_F CCAGAGCAAAGCAAAGAACC
Reverse Primer: S424_R CTACATCAACCCCACCTTGG
Reviews

Customers who bought this product also purchased
DYS590
DYS590
F3906
F3906
FGC3213
FGC3213
L362
L362
A67
A67
R1b-DF21 Panel
R1b-DF21 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies