Top » Catalog » SNPs » S424

$18.00

S424
[S424]

S424
hg38 Position: ChrY:15249500..15249500
Ancestral: A
Derived: C
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b1
Comments: .
Forward Primer: S424_F CCAGAGCAAAGCAAAGAACC
Reverse Primer: S424_R CTACATCAACCCCACCTTGG
Reviews

Customers who bought this product also purchased
DYS590
DYS590
F3906
F3906
Z18000
Z18000
DF5
DF5
Z16533
Z16533
FGC3197
FGC3197
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies