Top » Catalog » SNPs » Y21996

$18.00

Y21996
[Y21996]

Y21996
hg38 Position: ChrY:22314255..22314255
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: I2a2a1b2a
Comments: L801
Forward Primer: Y21996_F AATATTTGATGGGTTAATCTCTTTTTG
Reverse Primer: Y21996_R CATCCTGAAGGGCTTCTGC
Reviews

Customers who bought this product also purchased
DYS589
DYS589
FGC17393
FGC17393
S8104
S8104
DNA Sample Kit
DNA Sample Kit
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies