Top » Catalog » SNPs » FGC1696

$18.00

FGC1696
[FGC1696]

FGC1696
hg38 Position: ChrY:4008964..4008964
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1721
Forward Primer: FGC1696_F CAAAACAAATGATCGCACAACTTA
Reverse Primer: FGC1696_R TTCCTGAGACCTGTCTTAGATATTCAT
Reviews

Customers who bought this product also purchased
FGC8797
FGC8797
ZS3862
ZS3862
ZS3856
ZS3856
ZS8929
ZS8929
ZS7299
ZS7299
FGC8812
FGC8812
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies