Top » Catalog » SNPs » FGC1696

$18.00

FGC1696
[FGC1696]

FGC1696
hg38 Position: ChrY:4008964..4008964
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1721
Forward Primer: FGC1696_F CAAAACAAATGATCGCACAACTTA
Reverse Primer: FGC1696_R TTCCTGAGACCTGTCTTAGATATTCAT
Reviews

Customers who bought this product also purchased
ZS7539
ZS7539
BY38119
BY38119
FGC29838
FGC29838
FGC10592
FGC10592
FGC10599
FGC10599
A10526
A10526
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies