Top » Catalog » SNPs » FGC1696

$18.00

FGC1696
[FGC1696]

FGC1696
hg38 Position: ChrY:4008964..4008964
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1721
Forward Primer: FGC1696_F CAAAACAAATGATCGCACAACTTA
Reverse Primer: FGC1696_R TTCCTGAGACCTGTCTTAGATATTCAT
Reviews

Customers who bought this product also purchased
Z1853
Z1853
Z1865
Z1865
Z1889
Z1889
FGC39874
FGC39874
L829
L829
FGC12836
FGC12836
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies