Top » Catalog » SNPs » FGC1696

$18.00

FGC1696
[FGC1696]

FGC1696
hg38 Position: ChrY:4008964..4008964
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1721
Forward Primer: FGC1696_F CAAAACAAATGATCGCACAACTTA
Reverse Primer: FGC1696_R TTCCTGAGACCTGTCTTAGATATTCAT
Reviews

Customers who bought this product also purchased
BY78172
BY78172
ZS5804
ZS5804
ZS7282
ZS7282
BY138887
BY138887
ZS8379
ZS8379
ZS5814
ZS5814
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies