Top » Catalog » SNPs » FGC1696

$18.00

FGC1696
[FGC1696]

FGC1696
hg38 Position: ChrY:4008964..4008964
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1721
Forward Primer: FGC1696_F CAAAACAAATGATCGCACAACTTA
Reverse Primer: FGC1696_R TTCCTGAGACCTGTCTTAGATATTCAT
Reviews

Customers who bought this product also purchased
FGC48131
FGC48131
ZS8273
ZS8273
FT43969
FT43969
FGC16651
FGC16651
FT43313
FT43313
FGC38802
FGC38802
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies