Top » Catalog » SNPs » FGC1701

$18.00

FGC1701
[FGC1701]

FGC1701
hg38 Position: ChrY:7426495..7426495
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC11
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1701_F CCAGAATGTGGAGCCAAC
Reverse Primer: FGC1701_R ATATCTTTTCCCTCTCCCCTTC
Reviews

Customers who bought this product also purchased
ZS11114
ZS11114
ZS4087
ZS4087
Y184770
Y184770
ZS2050
ZS2050
BY6
BY6
BY4
BY4
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies