Top » Catalog » SNPs » FGC1705

$18.00

FGC1705
[FGC1705]

FGC1705
hg38 Position: ChrY:8002842..8002842
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1705_F CAGCCACATGTCACATTTCC
Reverse Primer: FGC1705_R AAAGCCCTTGGATGTTTTTG
Reviews

Customers who bought this product also purchased
Y200236
Y200236
Y161574
Y161574
ZS8332
ZS8332
ZS3856
ZS3856
FGC7
FGC7
FT9421
FT9421
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies