Top » Catalog » SNPs » FGC1705

$18.00

FGC1705
[FGC1705]

FGC1705
hg38 Position: ChrY:8002842..8002842
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1705_F CAGCCACATGTCACATTTCC
Reverse Primer: FGC1705_R AAAGCCCTTGGATGTTTTTG
Reviews

Customers who bought this product also purchased
FGC7944
FGC7944
FGC4415
FGC4415
FGC74930
FGC74930
Y80610
Y80610
Y64784
Y64784
A16016
A16016
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies