Top » Catalog » SNPs » FGC1705

$18.00

FGC1705
[FGC1705]

FGC1705
hg38 Position: ChrY:8002842..8002842
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1705_F CAGCCACATGTCACATTTCC
Reverse Primer: FGC1705_R AAAGCCCTTGGATGTTTTTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
ZS8506
ZS8506
FGC8812
FGC8812
ZS3862
ZS3862
FGC1713
FGC1713
ZS8929
ZS8929
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies