Top » Catalog » SNPs » FGC1707

$18.00

FGC1707
[FGC1707]

FGC1707
hg38 Position: ChrY:8687161..8687161
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1707_F ACCCAGCATCACTCCATTTC
Reverse Primer: FGC1707_R TCATTTTCCAGAAGCCAACC
Reviews

Customers who bought this product also purchased
Y36224
Y36224
ZS7531
ZS7531
ZS4760
ZS4760
FGC60148
FGC60148
Y130515
Y130515
ZS2167
ZS2167
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies