Top » Catalog » SNPs » FGC1707

$18.00

FGC1707
[FGC1707]

FGC1707
hg38 Position: ChrY:8687161..8687161
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1707_F ACCCAGCATCACTCCATTTC
Reverse Primer: FGC1707_R TCATTTTCCAGAAGCCAACC
Reviews

Customers who bought this product also purchased
FGC8712
FGC8712
FGC42781
FGC42781
ZS237
ZS237
Z18271
Z18271
ZS2478
ZS2478
S12192
S12192
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y20573
1 x HU198
$36.00
Haplogroup Info
Other products
Currencies