Top » Catalog » SNPs » FGC1707

$18.00

FGC1707
[FGC1707]

FGC1707
hg38 Position: ChrY:8687161..8687161
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1707_F ACCCAGCATCACTCCATTTC
Reverse Primer: FGC1707_R TCATTTTCCAGAAGCCAACC
Reviews

Customers who bought this product also purchased
BY527
BY527
Y182160
Y182160
FGC10401
FGC10401
BY181155
BY181155
ZS11634
ZS11634
FT269440
FT269440
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies