Top » Catalog » SNPs » FGC1707

$18.00

FGC1707
[FGC1707]

FGC1707
hg38 Position: ChrY:8687161..8687161
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1707_F ACCCAGCATCACTCCATTTC
Reverse Primer: FGC1707_R TCATTTTCCAGAAGCCAACC
Reviews

Customers who bought this product also purchased
M172
M172
Y12889
Y12889
FT362659
FT362659
ZS9306
ZS9306
Y20902
Y20902
ZS10633
ZS10633
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies