Top » Catalog » SNPs » FGC1707

$19.00

FGC1707
[FGC1707]

FGC1707
hg38 Position: ChrY:8687161..8687161
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1707_F ACCCAGCATCACTCCATTTC
Reverse Primer: FGC1707_R TCATTTTCCAGAAGCCAACC
Reviews

Customers who bought this product also purchased
FT102480
FT102480
ZS8988
ZS8988
FGC4244
FGC4244
FGC8
FGC8
Y134508
Y134508
ZS4227
ZS4227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies