Top » Catalog » SNPs » FGC1713

$18.00

FGC1713
[FGC1713]

FGC1713
hg38 Position: ChrY:12587386..12587386
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC1713_F GTGGATCGCGTATTTCTTCC
Reverse Primer: FGC1713_R AGCCTGTTAATTGGCTCCTG
Reviews

Customers who bought this product also purchased
A15552
A15552
A15550
A15550
ZS4753
ZS4753
BY4
BY4
ZS4205
ZS4205
ZS9443
ZS9443
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies