Top » Catalog » SNPs » FGC1713

$18.00

FGC1713
[FGC1713]

FGC1713
hg38 Position: ChrY:12587386..12587386
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC1713_F GTGGATCGCGTATTTCTTCC
Reverse Primer: FGC1713_R AGCCTGTTAATTGGCTCCTG
Reviews

Customers who bought this product also purchased
FGC12
FGC12
FGC8712
FGC8712
FGC42837
FGC42837
A12919
A12919
A14638
A14638
FGC52345
FGC52345
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies