Top » Catalog » SNPs » FGC1713

$17.50

FGC1713
[FGC1713]

FGC1713
HG19 Position: ChrY:14699320..14699320
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC1696
Comments: Downstream of J1-FGC1696
Forward Primer: FGC1713_F GTGGATCGCGTATTTCTTCC
Reverse Primer: FGC1713_R AGCCTGTTAATTGGCTCCTG
Reviews

Customers who bought this product also purchased
ZS9695
ZS9695
FGC4314
FGC4314
ZS10722
ZS10722
FGC19496
FGC19496
FGC10090
FGC10090
FGC10095
FGC10095
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11766
1 x A11670
1 x A10310
1 x A10509
1 x A11486
1 x A10370
1 x A10316
1 x A11088
1 x A10624
1 x A11145
1 x A10741
1 x A11740
1 x A11690
1 x A10231
1 x A10284
1 x A11244
1 x A11650
1 x A11124
1 x A10960
1 x A1
1 x A10880
1 x A10560
1 x A10666
1 x A10033
1 x A11627
1 x A11590
1 x A1147
1 x A11440
1 x A101
1 x A10615
1 x A11624
1 x A1069
1 x A11279
1 x A11473
1 x A10127
1 x A10934
1 x A10180
1 x A11720
1 x A10024
1 x A11054
1 x A10503
1 x A11538
1 x A11375
1 x A10927
1 x A10561
1 x A10674
1 x A1030
1 x A11174
1 x A11785
1 x A10557
1 x A10671
1 x A11532
1 x A10117
1 x A1159
1 x A11230
1 x A10291
1 x A11660
1 x A10755
1 x A11111
1 x A11506
1 x A11204
1 x A10221
1 x A10251
1 x A11390
1 x A11501
1 x A11771
1 x A10296
1 x A10554
1 x A10391
1 x A10664
1 x A11693
1 x A10228
1 x A1073
1 x A11758
1 x A10303
1 x A10035
1 x A10668
1 x A10071
1 x A10950
1 x A10226
1 x A11525
1 x A10134
1 x A10574
1 x A11534
1 x A10616
1 x A10532
1 x A11746
1 x A10235
1 x A10501
1 x A10626
1 x A10700
1 x A10989
1 x A11247
$1,627.50
Haplogroup Info
Other products
Currencies