Top » Catalog » SNPs » FGC1713

$18.00

FGC1713
[FGC1713]

FGC1713
HG19 Position: ChrY:14699320..14699320
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC1696
Comments: Downstream of J1-FGC1696
Forward Primer: FGC1713_F GTGGATCGCGTATTTCTTCC
Reverse Primer: FGC1713_R AGCCTGTTAATTGGCTCCTG
Reviews

Customers who bought this product also purchased
FGC42829
FGC42829
FGC4267
FGC4267
ZS8524
ZS8524
FGC1703
FGC1703
ZS1862
ZS1862
A14644
A14644
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies