Top » Catalog » SNPs » FGC1713

$18.00

FGC1713
[FGC1713]

FGC1713
hg38 Position: ChrY:12587386..12587386
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC1713_F GTGGATCGCGTATTTCTTCC
Reverse Primer: FGC1713_R AGCCTGTTAATTGGCTCCTG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M9
M9
Y86709
Y86709
ZS8508
ZS8508
FGC4353
FGC4353
FGC4340
FGC4340
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies