Top » Catalog » SNPs » FGC1713

$18.00

FGC1713
[FGC1713]

FGC1713
hg38 Position: ChrY:12587386..12587386
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC1713_F GTGGATCGCGTATTTCTTCC
Reverse Primer: FGC1713_R AGCCTGTTAATTGGCTCCTG
Reviews

Customers who bought this product also purchased
A13649
A13649
A19335
A19335
ZS4760
ZS4760
ZS11753
ZS11753
ZS7229
ZS7229
ZS9483
ZS9483
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies