Top » Catalog » SNPs » FGC1714

$18.00

FGC1714
[FGC1714]

FGC1714
hg38 Position: ChrY:12664511..12664511
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1714_F TTACTGGGCAACTCGTTCATC
Reverse Primer: FGC1714_R CACCCTTGAATCACCAACG
Reviews

Customers who bought this product also purchased
BY4
BY4
ZS11392
ZS11392
FGC4415
FGC4415
ZS11112
ZS11112
Y60807
Y60807
BY6
BY6
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies