Top » Catalog » SNPs » FGC16979

$18.00

FGC16979
[FGC16979]

FGC16979
hg38 Position: ChrY:15767936..15767936
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Downstream FGC16982 > S16136
Forward Primer: FGC16979_F ATGTTCCCCACACTCAATCC
Reverse Primer: FGC16979_R GATTAAGGTCAACCTCCACAATG
Reviews

Customers who bought this product also purchased
DF19
DF19
FGC17018
FGC17018
FGC17034
FGC17034
DF27
DF27
Y5049
Y5049
Y134723
Y134723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies