Top » Catalog » SNPs » FGC16979

$18.00

FGC16979
[FGC16979]

FGC16979
hg38 Position: ChrY:15767936..15767936
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Downstream FGC16982 > S16136
Forward Primer: FGC16979_F ATGTTCCCCACACTCAATCC
Reverse Primer: FGC16979_R GATTAAGGTCAACCTCCACAATG
Reviews

Customers who bought this product also purchased
Z29644
Z29644
BY15479
BY15479
U152
U152
DF99
DF99
BY15478
BY15478
P312
P312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies