Top » Catalog » SNPs » FGC1715

$18.00

FGC1715
[FGC1715]

FGC1715
hg38 Position: ChrY:13755865..13755865
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: Downstream of FGC1696 > FGC1715
Forward Primer: FGC1715_F CGCTCTGCCTGGAAGATTAC
Reverse Primer: FGC1715_R AAATATGGAGCCCAGGGTAAG
Reviews

Customers who bought this product also purchased
FGC4262
FGC4262
ZS9588
ZS9588
ZS7288
ZS7288
FGC7936
FGC7936
M168
M168
A13649
A13649
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies