Top » Catalog » SNPs » FGC1715

$18.00

FGC1715
[FGC1715]

FGC1715
hg38 Position: ChrY:13755865..13755865
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: Downstream of FGC1696 > FGC1715
Forward Primer: FGC1715_F CGCTCTGCCTGGAAGATTAC
Reverse Primer: FGC1715_R AAATATGGAGCCCAGGGTAAG
Reviews

Customers who bought this product also purchased
FGC5427
FGC5427
Y16746
Y16746
BY78172
BY78172
M96
M96
FT77163
FT77163
ZS5804
ZS5804
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies