Top » Catalog » SNPs » AF4

$18.00

AF4
[AF4]

AF4
HG19 Position: ChrY:8984707..8984707
Ancestral: A
Derived: C
Reference: Fernando Mendez (2012)
ISOGG Haplogroup: A00
Comments: Found in a hg A00 WTY participant
Forward Primer: AF4_F TCCTTACTCAGACTCATGGGG
Reverse Primer: AF4_R GCATATCCTGCCCTTTGC
Reviews

Customers who bought this product also purchased
AF10
AF10
R1b Saxon Rutherford's
R1b Saxon Rutherford's
CLFY15753
CLFY15753
CTS10
CTS10
AF7
AF7
A1
A1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies