Top » Catalog » SNPs » Z11827

$17.50

Z11827
[Z11827]

Z11827
HG19 Position: ChrY:17511533..17511533
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: B (not listed)
Comments: Equiv. to B2. Aka M8879
Forward Primer: Z11827_F TAAGGCTTGGTCCTCTCTGC
Reverse Primer: Z11827_R GCCCCACACAATCTGACAC
Reviews

Customers who bought this product also purchased
Wish a STR
Wish a STR
YFS514147
YFS514147
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies