Top » Catalog » SNPs » A10937

$18.00

A10937
[A10937]

A10937
hg38 Position: ChrY:7089235..7089235
Ancestral: C
Derived: T
Reference: Wanda Taylor (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > L48 > Z12 > A5616
Forward Primer: A10937_F TTTGTACAGACCGGTCTCACC
Reverse Primer: A10937_R CTCTTGCCCATCTAATCCTGTCT
Reviews

Customers who bought this product also purchased
A10944
A10944
R1b-U106 Tucker Panel
R1b-U106 Tucker Panel
A10943
A10943
A10942
A10942
A10940
A10940
A10938
A10938
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies