Top » Catalog » SNPs » Y18397

$18.00

Y18397
[Y18397]

Y18397
hg38 Position: ChrY:13112956..13112956
Ancestral: C
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y18397_F TATGGGATGAAACTGTCCTTAACAG
Reverse Primer: Y18397_R CTTTTGTTCCTCTGGGGTGA
Reviews

Customers who bought this product also purchased
CTS6804
CTS6804
CTS900
CTS900
Y23162
Y23162
Z30685
Z30685
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies