Top » Catalog » SNPs » FGC1721

$18.00

FGC1721
[FGC1721]

FGC1721
hg38 Position: ChrY:16066330..16066330
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1a1a
Comments: Downstream of J1-L222.2
Forward Primer: FGC1721_F ATCCACACATGTATAAAACATTCTTATCAG
Reverse Primer: FGC1721_R TGCACACAATAGCTGCAGAAC
Reviews

Customers who bought this product also purchased
Y14282
Y14282
ZS12606
ZS12606
BY4
BY4
ZS4062
ZS4062
BY8
BY8
BY9
BY9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies