Top » Catalog » SNPs » FGC1721

$18.00

FGC1721
[FGC1721]

FGC1721
hg38 Position: ChrY:16066330..16066330
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1a1a
Comments: Downstream of J1-L222.2
Forward Primer: FGC1721_F ATCCACACATGTATAAAACATTCTTATCAG
Reverse Primer: FGC1721_R TGCACACAATAGCTGCAGAAC
Reviews

Customers who bought this product also purchased
FGC4411
FGC4411
ZS1948
ZS1948
FGC47787
FGC47787
FGC4421
FGC4421
FGC19202
FGC19202
YFS052695
YFS052695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies