Top » Catalog » SNPs » FGC1721

$18.00

FGC1721
[FGC1721]

FGC1721
HG19 Position: ChrY:18178210..18178210
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Downstream of J1-L222.2
Forward Primer: FGC1721_F ATCCACACATGTATAAAACATTCTTATCAG
Reverse Primer: FGC1721_R TGCACACAATAGCTGCAGAAC
Reviews

Customers who bought this product also purchased
FGC4415
FGC4415
ZS1951
ZS1951
FGC1695
FGC1695
BY136
BY136
ZS10753
ZS10753
Y14282
Y14282
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies