Top » Catalog » SNPs » FGC20473

$18.00

FGC20473
[FGC20473]

FGC20473
HG19 Position: ChrY:7611504..7611504
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I2
Comments: Downstream M423 > L621 > CTS4002 > FGC20479
Forward Primer: FGC20473_F ATCTTCTAAAATAAAGTAATCATCACTAATCTG
Reverse Primer: FGC20473_R GAATGTGGACATCTTTCTGTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies