Top » Catalog » SNPs » FGC20473

$18.00

FGC20473
[FGC20473]

FGC20473
HG19 Position: ChrY:7743463..7743463
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I2
Comments: Downstream M423 > L621 > CTS4002 > FGC20479
Forward Primer: FGC20473_F ATCTTCTAAAATAAAGTAATCATCACTAATCTG
Reverse Primer: FGC20473_R GAATGTGGACATCTTTCTGTGTC
Reviews

Customers who bought this product also purchased
S17250
S17250
A16633
A16633
CTS10228
CTS10228
YP198
YP198
L161.1
L161.1
FGC20479
FGC20479
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies