Top » Catalog » SNPs » FGC20473

$18.00

FGC20473
[FGC20473]

FGC20473
HG19 Position: ChrY:7743463..7743463
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I2
Comments: Downstream M423 > L621 > CTS4002 > FGC20479
Forward Primer: FGC20473_F ATCTTCTAAAATAAAGTAATCATCACTAATCTG
Reverse Primer: FGC20473_R GAATGTGGACATCTTTCTGTGTC
Reviews

Customers who bought this product also purchased
I2a-M423 Panel
I2a-M423 Panel
F3145
F3145
S2679
S2679
S17250
S17250
A16633
A16633
CTS10228
CTS10228
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies