Top » Catalog » SNPs » FGC20479

$18.00

FGC20479
[FGC20479]

FGC20479
hg38 Position: ChrY:8859144..8859144
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I2
Comments: Downstream M423 > L621 > CTS4002
Forward Primer: FGC20479_F TTTTTCTATTTAATAGTGATTCTGAAAGTCC
Reverse Primer: FGC20479_R GAACCAACTGAGTTTTTAAATTCATG
Reviews

Customers who bought this product also purchased
L161.1
L161.1
YP198
YP198
I2a-M423 Panel
I2a-M423 Panel
F3145
F3145
S2679
S2679
S17250
S17250
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies