Top » Catalog » SNPs » FGC20479

$18.00

FGC20479
[FGC20479]

FGC20479
HG19 Position: ChrY:8859144..8859144
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I2
Comments: Downstream M423 > L621 > CTS4002
Forward Primer: FGC20479_F TTTTTCTATTTAATAGTGATTCTGAAAGTCC
Reverse Primer: FGC20479_R GAACCAACTGAGTTTTTAAATTCATG
Reviews

Customers who bought this product also purchased
S17250
S17250
FGC20473
FGC20473
CTS10228
CTS10228
A16633
A16633
L161.1
L161.1
YP198
YP198
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies