Top » Catalog » SNPs » FGC41973

$18.00

FGC41973
[FGC41973]

FGC41973
hg38 Position: ChrY:7385958..7385958
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: G2a2b2b1b
Comments: Below PF3416.
Forward Primer: FGC41973_F GACTGGAGAAGTGGCCTAGACTG
Reverse Primer: FGC41973_R GGGAACAAGTTACCCATTTGC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Wish a SNP
Wish a SNP
PF3375
PF3375
FGC52664
FGC52664
FGC52604
FGC52604
FGC52601
FGC52601
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies