Top » Catalog » SNPs » BY4455

$18.00

BY4455
[BY4455]

BY4455
hg38 Position: ChrY:14441796..14441796
Ancestral: A
Derived: G
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: Below V13 > Z5016 > Z17107> Z38456
Forward Primer: BY4455_F CTATTCTCCAATGCAATCATGTTG
Reverse Primer: BY4455_R CCTACTTACGAGTGAGAACATGGC
Reviews

Customers who bought this product also purchased
Z16988
Z16988
S19928
S19928
Y97307
Y97307
Z5018
Z5018
BY4600
BY4600
BY4461
BY4461
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies