Top » Catalog » SNPs » BY4455

$18.00

BY4455
[BY4455]

BY4455
hg38 Position: ChrY:14441796..14441796
Ancestral: A
Derived: G
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: Below V13 > Z5016 > Z17107> Z38456
Forward Primer: BY4455_F CTATTCTCCAATGCAATCATGTTG
Reverse Primer: BY4455_R CCTACTTACGAGTGAGAACATGGC
Reviews

Customers who bought this product also purchased
Z5017
Z5017
S26015
S26015
Z38456
Z38456
E1b-V13 Panel
E1b-V13 Panel
SK888
SK888
Z17107
Z17107
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies