Top » Catalog » SNPs » MZ117

$18.00

MZ117
[MZ117]

MZ117
hg38 Position: ChrY:16088239..16088239
Ancestral: C
Derived: T
Reference: Hamma Bachir (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Downstream of PF2546
Forward Primer: MZ117_F CCTTCTGGGTCATGGACAGT
Reverse Primer: MZ117_R CAAATGCCTCATCTCCCTTTC
Reviews

Customers who bought this product also purchased
MZ217
MZ217
BY10290
BY10290
FGC22844
FGC22844
MZ223
MZ223
A2227
A2227
BY10323
BY10323
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies