Top » Catalog » SNPs » FGC52744

$18.00

FGC52744
[FGC52744]

FGC52744
hg38 Position: ChrY:13784344..13784344
Ancestral: G
Derived: A
Reference: Full Genomes (2016)
ISOGG Haplogroup: I1
Comments: below FGC17586
Forward Primer: FGC52744_F TGAGACAAAATTTCGCTGTTG
Reverse Primer: FGC52744_R TGGTGGGTGCAGAGTATGTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies