Top » Catalog » SNPs » FGC52379

$18.00

FGC52379
[FGC52379]

FGC52379
hg38 Position: ChrY:2929244..2929244
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC52379_F TGTCAGACAAGGCTGAGTGC
Reverse Primer: FGC52379_R GCTGCAGACTGTGAAAATGG
Reviews

Customers who bought this product also purchased
R1b-FGC52382 Adams Panel
R1b-FGC52382 Adams Panel
Y4781
Y4781
FGC58785
FGC58785
A12274
A12274
A12277
A12277
FGC52382
FGC52382
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies