Top » Catalog » SNPs » FGC1723

$18.00

FGC1723
[FGC1723]

FGC1723
hg38 Position: ChrY:16841699..16841699
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1723_F TGTATGGGCAGGGCATAG
Reverse Primer: FGC1723_R GGCTGGGGTTAGGAGAGAAG
Reviews

Customers who bought this product also purchased
ZS11645
ZS11645
BY16791
BY16791
ZS4740
ZS4740
M96
M96
Y60807
Y60807
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies