Top » Catalog » SNPs » FGC1723

$18.00

FGC1723
[FGC1723]

FGC1723
hg38 Position: ChrY:16841699..16841699
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1723_F TGTATGGGCAGGGCATAG
Reverse Primer: FGC1723_R GGCTGGGGTTAGGAGAGAAG
Reviews

Customers who bought this product also purchased
MF113321
MF113321
ZS10710
ZS10710
ZS11645
ZS11645
BY16791
BY16791
ZS4740
ZS4740
M96
M96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies