Top » Catalog » SNPs » A12274

$18.00

A12274
[A12274]

A12274
hg38 Position: ChrY:13346341..13346341
Ancestral: C
Derived: T
Reference: James Adams (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A12274_F CCTTTCTGGACTAAAGGGCC
Reverse Primer: A12274_R CTTGTCCCAATGGGTGATG
Reviews

Customers who bought this product also purchased
A12275
A12275
R1b-FGC52382 Adams Panel
R1b-FGC52382 Adams Panel
Y4781
Y4781
FGC58785
FGC58785
A12277
A12277
FGC52379
FGC52379
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies