Top » Catalog » SNPs » FGC52317

$18.00

FGC52317
[FGC52317]

FGC52317
HG19 Position: ChrY:7162521..7162521
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC52317_F CTCATTTTATAAGGATAGCAAAAGCG
Reverse Primer: FGC52317_R CTGTATATATGCATGACATTTTCTTTACC
Reviews

Customers who bought this product also purchased
FGC22516
FGC22516
FGC52320
FGC52320
FGC52326
FGC52326
R1b-FGC22516 Panel
R1b-FGC22516 Panel
FGC53430
FGC53430
FGC53427
FGC53427
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies