Top » Catalog » SNPs » FGC52317

$18.00

FGC52317
[FGC52317]

FGC52317
hg38 Position: ChrY:7162521..7162521
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC52317_F CTCATTTTATAAGGATAGCAAAAGCG
Reverse Primer: FGC52317_R CTGTATATATGCATGACATTTTCTTTACC
Reviews

Customers who bought this product also purchased
FGC22516
FGC22516
FGC53427
FGC53427
FGC53426
FGC53426
FGC52322
FGC52322
FGC52320
FGC52320
FGC52326
FGC52326
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies