Top » Catalog » SNPs » FGC53426

$18.00

FGC53426
[FGC53426]

FGC53426
hg38 Position: ChrY:13660665..13660665
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b
Comments: Downsteam FGC22516
Forward Primer: FGC53426_F GCTGGACTGTTGTCACGTTG
Reverse Primer: FGC53426_R TCCCCGACTGAAACAGAATG
Reviews

Customers who bought this product also purchased
FGC42112
FGC42112
FGC66925
FGC66925
A11972
A11972
FGC66921
FGC66921
A11966
A11966
FGC53415
FGC53415
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies