Top » Catalog » SNPs » FGC53426

$18.00

FGC53426
[FGC53426]

FGC53426
hg38 Position: ChrY:13660665..13660665
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b
Comments: Downsteam FGC22516
Forward Primer: FGC53426_F GCTGGACTGTTGTCACGTTG
Reverse Primer: FGC53426_R TCCCCGACTGAAACAGAATG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies